Scientific Bridge Page (Wet Lab → Computational Handoff)

DNA Sequencing Workflow: From Purified DNA to Genetic Information

The vital connecting link in molecular genomics: receiving high-purity DNA from any of my 5 Wet Lab extraction protocols, constructing sequencing libraries, generating raw FASTQ reads via Illumina & Nanopore platforms, and feeding data directly into bioinformatics pipelines.

Input: Purified Genomic DNA Output: FASTQ / Chromatogram Files Platforms: Sanger, Illumina NGS, Oxford Nanopore Author: Usama Bin Ali (Bioinformatics Researcher) ~12 min read

Overview of DNA Sequencing

DNA sequencing determines the exact order of nucleotide bases (&Adenine;, &Thymine;, &Guanine;, &Cytosine;) within a DNA molecule.

# Example 50-bp Nucleotide Sequence Read:
5'- ATGCGTAGCTGATCGATCGATCGATCGATCGATCGATCGATCGATCGA -3'

01 Wet Lab DNA Handoff

High-purity genomic DNA is delivered directly from any of my 5 Wet Lab projects:

1. CTAB Plant DNA

High molecular weight plant genomic DNA.

2. Blood DNA

Ultra-pure clinical human leukocyte DNA.

3. Hair DNA

Forensic hair follicle root genomic DNA.

4. Sperm DNA

DTT-reduced protamine sperm DNA.

5. Saliva DNA

Qubit quantified oral cheek cell DNA.

02 DNA Fragmentation

Acoustic sonication (Covaris) or enzymatic transposase cleavage fragments long genomic DNA into 300–500 bp inserts suitable for short-read sequencing platforms.

03 End Repair & Adapter Ligation

DNA ends are repaired, A-tailed, and ligated with synthetic platform-specific oligonucleotide adapters containing sample index barcodes.

04 Library Amplification & Preparation

Low-cycle high-fidelity PCR amplifies adapter-ligated DNA fragments into a sequencing library.

05 Library Quality Assessment

Library fragment size distribution is verified on an Agilent Bioanalyzer (expected peak ~450 bp) and quantified using Qubit dsDNA HS assay.

Major DNA Sequencing Platforms

Sanger Sequencing (1st Gen)

Capillary electrophoresis with ddNTP chain terminators. Read length: 800–1000 bp. Accuracy: >99.99%.

Illumina NGS (2nd Gen)

Reversible terminator sequencing-by-synthesis (SBS). Billions of short paired-end reads (150–300 bp).

Oxford Nanopore (3rd Gen)

Direct ionic current changes through protein nanopores. Real-time ultra-long reads (>100 kb).

FASTQ File Format & Base Calling

Raw optical signals are base-called into FASTQ text records consisting of 4 lines per read:

@SEQ_ID_001:ILLUMINA:7:1101:1234:2000 1:N:0:ATCACG
GATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGA
+
FFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFF

Sanger Chromatogram Peak Analysis

Sanger capillary electrophoresis outputs 4-color fluorescence peak traces representing A (Green), C (Blue), G (Black), and T (Red).

↔

Overlapping / Noisy Peaks Clean Resolved Sanger Trace

Transition to Bioinformatics Pipeline

Once raw FASTQ sequencing files are generated, the wet lab experimental phase is complete. Data transitions immediately into downstream computational processing:

1. Raw FASTQ Data

→

2. FastQC Quality Control

→

3. BWA / STAR Alignment

→

4. GATK Variant Calling

→

5. Biological Discovery

Explore my full Bioinformatics Pipeline Service →

Graph & Quality Score Interpretation

Phred Quality Score (Q30)

Q30 represents 1 error per 1,000 base calls (99.9% accuracy standard for NGS).

Coverage Depth Plot

Average 30X genome coverage ensures accurate heterozygous variant detection.

Complete 11-Stage Sequencing Journey

Stage 1–5: DNA Handoff & Library Preparation

Purified DNA intake from Wet Lab, sonication fragmentation, adapter ligation, and Bioanalyzer QC.

Stage 6–11: Flow Cell Sequencing & FASTQ Handoff

Illumina SBS or Nanopore run, base calling, FASTQ generation, and transfer to Bioinformatics pipeline.

References

Sanger, F., Nicklen, S., & Coulson, A. R. (1977). DNA sequencing with chain-terminating inhibitors. PNAS, 74(12), 5463-5467.
Bentley, D. R., et al. (2008). Accurate whole human genome sequencing using reversible terminator chemistry. Nature, 456(7218), 53-59.